NEXTFLEX® PCR-Free DNA-Seq Kit for Illumina® Platforms
- Eliminates amplification bias and poor sequence representation
- Improves read mapping
- Reduces duplicate sequences
- Better de novo assembly
- As little as 500 ng of input DNA needed
- Enhanced adapter ligation technology with NEXTFLEX® Ligation
- Flexible barcode options – NEXTFLEX® PCR-Free Barcode kits contain 6, 12, 24, or 48 unique barcodes
- Bead-based cleanup protocol
- Automation-friendly workflow is compatible with liquid handlers
- Barcoded adapters for multiplexing contain embedded index sequence
Eliminate the Need for Amplification
Amplifying AT or GC rich genomic regions often leads to sequence biased nucleotide compositions and poses a serious challenge during analysis. Using specially designed master-mixed enzymes, the NEXTFLEX® PCR-Free DNA Library Prep Kit completely eliminates the need for amplification, enabling better read mapping and a reduction in duplicate sequences, leading to reduced sequence cost and bias, for more representative base identities and better de novo assembly.
In addition, the NEXTFLEX® PCR-Free DNA Sequencing Kit features patent pending Enhanced Adapter Ligation Technology, resulting in library preps with a larger number of unique sequencing reads. With these improvements to the ligation enzymatic mix, the user will now have the ability to perform ligations with longer adapters, and can expect to see better binding efficiencies. The NEXTFLEX® PCR-Free Sequencing Kit simplifies workflow by using master mixed reagents and magnetic bead based cleanup, reducing pipetting and eliminating time consuming steps in library preparation.
Exceptional Multiplexing Capabilities
Using the NEXTFLEX® PCR-Free Barcodes, the user can index 6, 12, 24, or 48 samples at once providing exceptional sequencing capacity.
The NEXTFLEX® PCR-Free DNA Sequencing Kit is designed to prepare gel-free libraries using magnetic bead based size selection from as little as 500 ng of input DNA. If you have specific insert size requirements and would like to perform agarose gel size selection, we recommend the NEXTFLEX® Agarose Gel Size Selection Kit.
Automation Solutions
The NEXTFLEX® PCR-Free DNA Sequencing Kit and NEXTFLEX® PCR-Free Modules are automated on the Tecan Freedom EVO Workstation. For more information about this customer developed automation solution read Tecan’s article, GeT with the NGS program, published in the Tecan Journal.
For larger volume requirements, customization and bulk packaging is available. For increased flexibility individual reagents (non-master mixed) are also available. Please contact info@mediray.co.nz for further information.
KIT CONTENTS
- NEXTFLEX® PCR-Free End Repair Buffer Mix
- NEXTFLEX® PCR-Free End Repair Enzyme Mix
- NEXTFLEX® PCR-Free Adenylation Mix
- NEXTFLEX® PCR-Free Ligation Mix
- NEXTFLEX® PCR-Free DNA Adapter (50 µM)
- Nuclease-free Water
- Resuspension Buffer
REQUIRED MATERIALS NOT PROVIDED
- 500 ng to 3 µg of fragmented genomic DNA in up to 40 µL nuclease-free water.
- NEXTFLEX® PCR-Free Barcodes – 6 / 12 / 24 / 48 (Cat # 514110, 514111, 514112, 514113)
- Ethanol 80% (room temperature)
- 96-well PCR Plate Non-skirted (Phenix Research, Cat # MPS-499) / or / similar
- 96-well Library Storage and Pooling Plate (Fisher Scientific, Cat # AB-0765) / or / similar
- Adhesive PCR Plate Seal (BioRad, Cat # MSB1001)
- Agencourt AMPure XP 5 mL (Beckman Coulter Genomics, Cat # A63880)
- Magnetic Stand -96 (Ambion, Cat # AM10027) / or / similar
- Heat block
- Thermocycler
- 2, 10, 20, 200 and 1000 µL pipettes / multichannel pipettes
- Nuclease-free barrier pipette tips
- Microcentrifuge
- 1.5 mL nuclease-free microcentrifuge tubes
- Vortex
- qPCR Library Quantification Kit / or / the following components:
- qPCR dilution buffer: 10 mM Tris HCl pH 8.0, 0.05% Tween 20
- Control Templates
- qPCR Primer 1 – HPLC Purified – 5’AATGATACGGCGACCACCGA -3’
- qPCR Primer 2 – HPLC Purified – 5’CAAGCAGAAGACGGCATACGA -3’